Rapid communication: Mapping of the pro-opiomelanocortin (POMC) gene to pig chromosome by linkage analysis using a PCR-RFLP.

Marker Name. Pro-opiomelanocortin (POMC). Genus and Species. Sus scrofa. Source and Description of Primers. Primers were designed to amplify pig genomic DNA from exon 2 to exon 3 using porcine POMC cDNA sequence (Genbank accession no. X03561), based on exon/intron boundary and intron size information of bovine (Genbank J00019) and human (Genbank J00291, J00292) POMC sequences. Primer Sequences. Forward primer: 5′TGCCTGGAAGATGCCGAGAT3′. Reverse primer: 5′AAGTGGCCCATGACGTACTT3′. Method of Detection. PCR amplification was performed in a 10L reaction volume using 50 ng of genomic DNA, 0.5 units Taq polymerase (Sigma-Aldrich, St. Louis, MO) with the supplied MgCl2-free buffer, 0.8 mM MgCl2, 200 M each dNTP, 150 nM each primer, and 1× RediLoad (Research Genetics, Huntsville, AL). “Touchdown” thermal cycling consisted of 10 cycles with annealing temperature starting at 65°C and decreasing 1°C per cycle, followed by 30 cycles with 55°C annealing temperature. Description of Polymorphism. The ∼2,600-bp PCR product was digested with HaeIII to reveal a polymorphism with two alleles (Figure 1), with major bands at 1,100, 460, and 230 bp (allele A) or 670, 460, 380, and 230 bp (allele B). Smaller polymorphic bands were observed, but due to poor resolution they were not used for linkage analysis. Sequencing of the purified PCR product yielded a 128-bp conserved region of exon 2 with homologies of 100% to known pig POMC sequence (Genbank S73519), 95% to known human, macaca, and bovine POMC sequences (Genbank XM_002485, M19658 and V00107, respectively), and 85% to known mouse POMC sequence (Genbank NM_008895). Inheritance Pattern. A Mendelian pattern of inheritance of POMC was observed in three full-sib families (45 offspring).